The regulatory role of macrophages in diabetic wound healing and a study of the mechanisms involved
Linian Peng1,2,Zhihui Liu1,2,Yong Huang1,2,Weifeng He1,2,*,Gaoxing Luo1,2,*
1State Key Laboratory of Trauma, Burn and Combined Injury, Institute of Burn Research,
Southwest Hospital, Third Military Medical University (Army Medical University), 400000,
Chongqing, China;
2Department of Disease Proteomics, Chongqing Key Laboratory for Disease Proteomics,
400000, Chongqing, China;
*Correspondence.Weifeng He, Email: whe761211@hotmail.com
;Gaoxing Luo, Email: logxw@yahoo.com
Funding
This work was supported by grants from the National Natural Sciences Foundation of China (No. 81630055 and No. 81920108022 to GXL; No. 82172232 and No. 31872742 to WFH), the Military Medical Science and Technology Youth Training Program of the Army Military Medical University (Third Military Medical University) (No. 20QNPY024 to WFH) and the Special Project for Enhancing Science and Technology Innovation Ability (frontier exploration) of the Army Military Medical University (Third Military Medical University) (No. 2019XQY12 to WFH).
Abstract
Objective: To elucidate the pathophysiological mechanisms underlying the poor healing of diabetic wounds, to reveal the abnormal functions of macrophages in diabetic wounds, and to explore novel pathogenic mechanisms and therapeutic targets for diabetes mellitus (DM).
Methods: Type I diabetic mice were induced using streptozotocin (STZ). A full-thickness dorsal skin model was prepared in mice for gross observation, and tissue from the wound site was collected for paraffin-section staining. Primary murine macrophages were isolated, and cell culture models representing high glucose conditions and impaired glucose utilization were established as experimental groups. Techniques including immunofluorescence (IF), immunohistochemistry (IHC), real-time fluorescence quantitative polymerase chain reaction (RTFQ-PCR), and Western blotting (WB) were employed to quantitatively analyze the expression of genes related to phagocytosis, oxidative stress (OS), inflammatory proteins, polarization, and apoptosis.
Results: Compared with the control group, the diabetic experimental group exhibited delayed wound healing, reduced phagocytic function, elevated oxidative stress, imbalanced macrophage polarization, heightened inflammatory responses, and excessive cellular apoptosis.
Conclusion: Impaired wound healing in diabetes is intricately linked to hyperglycemia-induced macrophage dysfunction. Therapeutic strategies such as employing endocytosis-mimicking dressings, modulating macrophage polarization, supplementing anti-inflammatory factors, and monitoring the kelch like-ech associated protein1（Keap1）-nuclear factor erythroid 2-related factor 2（Nrf2） ratio as well as nod-like receptor family pyrin domain containing3（Nlrp3） inflammasome activity show promising potential and warrant further investigation to achieve personalized treatments.
Keywords:Diabetic wound healing; macrophage dysfunction; phagocytosis; inflammatory regulation; M1/M2 polarization; oxidative stress
Key message :
What is already known on this topic：Existing research has demonstrated that diabetic wound healing is chronic, characterized by a disrupted healing environment that deviates from the wound healing process under physiological conditions.
What is this study adds:For the first time, a dual metabolic dysregulation model induced by high glucose and 2DG was established. This study revealed a triple defect in phagocytosis, polarization, and inflammation, as well as a malignant feedback loop between the Keap1-Nrf2 pathway and the Nlrp3 inflammasome, and proposed targeted intervention strategies.
How this study might affect research, practice or policy：This study provides new targets for the treatment of diabetic wounds, advances personalized medicine, and extends its research to the treatment of diabetic complications.
Introduction
Skin tissue repair is a complex process that is crucial for defense and homeostasis [1,2]. Injuries such as burns, diabetic ulcers, and combat wounds heal slowly due to their intricate mechanisms [3,4]. In China, the number of chronic diabetic wound cases exceeds that of general traumatic wounds; however, current treatment methods are costly and ineffective, thereby necessitating novel therapeutic strategies [5,6]. Diabetic wounds exhibit a compromised microenvironment, including oxidative stress (OS) and dysregulated inflammatory responses, but their underlying mechanisms remain unclear and warrant further investigation.
Wound healing encompasses four phases: hemostasis, inflammation, proliferation, and remodeling, with macrophages playing a pivotal role [7]. Initially, platelet activation triggers coagulation and the release of growth factors, thereby establishing a microenvironment conducive to healing [8,9]. Subsequently, neutrophils initiate inflammation and recruit monocytes that differentiate into macrophages [10,11]. These macrophages secrete bioactive molecules that activate fibroblasts, endothelial cells, and keratinocytes [12]. During the proliferation phase, macrophages promote angiogenesis via vascular endothelial growth factor (VEGF), while fibroblasts synthesize the extracellular matrix [7,19].Macrophages recognize damage-associated molecular patterns (DAMPs) and pathogen-associated molecular patterns (PAMPs) via pattern recognition receptors (PRRs), triggering nonspecific immune responses [21-23]. In patients with diabetes mellitus (DM), macrophages are impaired in various immune responses, and the mechanisms underlying this impairment warrant further investigation.
This study breakthroughly reveals a novel mechanism underlying impaired wound healing in diabetes, wherein macrophages exhibit aberrant behavior within the diabetic environment, offering new targets and strategies for diabetic treatment.
Materials and Methods
Mouse and skin creation
Male C57BL/6J wild-type mice, 6-8 weeks old, weighing about 20 g, were provided by the Experimental Center of Army Military Medical University and housed in the Animal Experiment Center of Southwest Hospital. The mice were fasted and dehydrated for 12 hours before the experiment, and the experimental group was injected intraperitoneally with 120 mg/kg streptozotocin (STZ), adjusting citrate buffer pH=4.5, and the control group was injected with an equal amount of the buffer for 3 consecutive days, and those with tail vein blood glucose >16.7 mmol/L were measured after 1 week were considered as the experimental group.Both groups were anesthetized with 1% sodium pentobarbital at a dose of 7.5 ml/kg. Two 6 mm circular traumas were made after dorsal hair removal and kept in a single cage. The wounds were photographed and recorded on days 0, 2, 4, 6 and 8 with a 3M adhesive ring scale. The degree of epithelialization of the traumatic histopathological structures was observed, including the measurement of the thickness and length of the neoplastic epithelium and the percentage of healed area of the trauma, healed area of the trauma (%) = 1 – unhealed area X 100%. It was analyzed by ImageJ software.
Tissue sampling and paraffin sectioning
Tissues were taken from the traumatic surfaces of mice in the model and control groups on days 2, 4, 6 and 8 after surgery. After anesthesia, the skin was cut at a distance of 3mm from the trauma edge, and the subcutaneous tissue was removed and fixed in five times the volume of 4% paraformaldehyde solution at 4°C for 48 hours. Subsequently, the tissue was dehydrated, clarified, embedded in paraffin wax, prepared into 5 μm slices, spread in a water bath at 40°C, adhered to the slides, and labeled to be dried at room temperature for 1 hour, and then preserved at 4°C.
Paraffin section staining
Paraffin sections were baked at 60°C for 20 minutes, after routine dewaxing: (1) hematoxylin and eosin(H&E)staining: hematoxylin-eosin staining, dehydrated and sealed; (2) Masson staining: Weigert iron hematoxylin staining, hydrochloric acid alcohol differentiation, aniline blue coloring for 10min, washed and sealed; (3) immunohistochemistry（IHC）: after antigen repair, endogenous enzyme was blocked, closed for 20 minutes, primary antibody (1:200, Abcam，UK) added overnight at 4°C, biotin-labeled goat anti-rabbit IgG added for 15 minutes , horseradish-labeled streptavidin working solution added dropwise, dolichos biflorus agglutinin(DAB) coloring.
Cell extraction and cell processing
Femur and tibia of 6-8 weeks C57BL/6J mice were taken, muscle was removed after sterilized with 75% alcohol, bone marrow was rinsed with phosphate buffer saline（PBS）, filtered at 0.45 μm, and centrifuged at 1500 g for 5 minutes. Cells were inoculated at 2×10⁶/well in roswell park memorial institute(RPMI)1640 medium （Gibco, USA)）containing 20 ng/mL of macrophage colony-stimulating factor (MCSF) (ABclonal, CHN), 100 μg/mL of penicillin-streptomycin-amphotericin B mixture ( Solarbio, CHN) and 10% fetal bovine serum (FBS) (Gibco, USA) in RPMI1640 medium, and cultured at 37°C with 5% CO₂ for 5 days to induce bone marrow-derived macrophage maturation. The matured primary macrophages on day 5 were washed by PBS and treated in groups: (1) 10 mM glucose group, 10 mM glucose plus 2-deoxy-d-glucose (2DG )group, 17.5 mM glucose group and 17.5 mM glucose plus 2DG group. (2) repeat the above four groups with 100 ng/mL interleukin-4(IL-4)or 40 ng/mL lipopolysaccharide (LPS), respectively. Each group was treated with 1 mL of medium/well for 24 hours at 37°C, 95% humidity and 5% CO₂ in a low oxygen incubator.
Cell immunofluorescence（IF）
Treated mature primary macrophages were washed three times with phosphate buffer PBS for 5 minutes each time, discarded, and fixed with 4% paraformaldehyde for 15-30 minutes at room temperature; they were closed with primary antibody blocking solution (Beyotime,CHN) for 2 hours at room temperature, then incubated with wet cassette primary antibody at 4°C overnight with cluster of differentiation（CD） 86, inducible nitric oxide synthase (iNOS), CD206, Arginase1(Arg1) (1:200, Abcam,UK),the next day the wet cassette was left at room temperature for 30 minutes, then incubated with secondary antibodies AF488 and AF555 (1:1000, Abcam,UK) for 1 hour at room temperature, then dihydrochloride (DAPI) (Beyotime,CHN) was added dropwise, the nuclei were stained for 5 minutes, blocked, and visualized by inverted fluorescence microscope with a magnification of 20X.
Total RNA acquisition and real-time fluorescence quantitative polymerase chain reaction(RTFQ-PCR) assay
Total RNA was extracted from mature primary macrophages using RNAiso PULS (Takara Bio, CHN) reagent, and reverse transcription was performed using 2XSP qPCR Mix (Bioground, CHN) and HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, CHN) to synthesize cDNA, followed by RTFQ-PCR. GCCTTGTAGACACCTTGGTCTT-3′; mouse transforming growth factor（TGF-β） forward primer 5′-AAAAGCAGTCAGCTGGCCTT
3′ and reverse primer 5′-GCAATGCAGACGAAGCAGAC-3′; mouse IL-6 forward primer 5′-ACAAAGCCAGAGAGTCCTTCAGAGAG-3′ and reverse primer 5′-ACAAAGCCAGAGTCCTTCAGAG-3′; mouse IL-6 forward primer 5′-ACAAAGCCAGAGAGTCCTTCAGAG ‘and reverse primer 5′-TCTGTGACTCCAGCTTATCTCTTG-3′; mouse IL-12 forward primer 5’-TGTGTCAATCACGCTACCTCC-3 ‘ and reverse primer 5′-ATGACCCTGGCCAAACTGAG-3′; mouse IL-1β forward primer 5′-GCCACCTTTTGACAGTGATG-3′ and reverse primer 5′-TTGGAAGCAGCCCTTCATCTT-3′; mouse CD16 forward primer 5′-TGCACACTCTGGAAGCCAAT-3′ and reverse primer 5′-CTCTGGGAAGCCAAT-3′; mouse IL-1β forward primer 5’-GCCACACTCTGGAAGCCAAT ‘-CTCTGCCTGTCTGCAAAAGC-3′; mouse CD32 forward primer 5′-ATGGGCTGTGATCGGAACTG-3′ and reverse primer 5′-ACTGGCATGAGAAT ACTGGCATGAGAATGCCTCC-3′; mouse AP-1 forward primer 5′-ACTGGCATGAGAATGCCTCC-3′ and reverse primer 5′-TTGGGGCACAATGCCTCC TTGGGGCACAAGCTTTCTGA-3′; mouse AP-2 forward primer 5′-TGTATCCAAAGGCGATGGCA-3′ and reverse primer 5′- AGCCTCTTTGCTCTCTTGCAGT-3′; mouse AP-3 forward primer 5′-ACTGCTTCAACGTCACCCTC-3′ and reverse primer 5′- GAGCGTTCCTTGCTCCTTCT-3′; mouse AP-4 forward primer 5′-CTTGCACAGTTTGCCAGGTC-3′ and reverse primer 5′- CCTCCACCTTCTGGAGCTTG
-3’; reaction conditions: 95°C denaturation for 2 minutes ; 95°C denaturation for 15 seconds, 55°C annealing for 35 seconds, 72°C extension for 31 seconds, a total of 40 loops. The reaction was analyzed using the Bio-Rad CFX Manager 3.1 system software.
Western bloting (WB) detection of target proteins
Mature primary macrophages were processed, RIPA lysis buffer was added to extract cellular proteins, BCA kit (Thermo, USA) was used to detect the protein concentration and adjust the number of proteins, 1X loading buffer (Yamay biotech, CHN) was added, boiled at 100°C for 10 minutes, and then made into samples, configured with SDS-PAGE gel (Yamay biotech, CHN), 30μg of sample volume per well, voltage upper gel 80V, lower gel 100V, membrane transfer, and incubation. (Yamay biotech, CHN), 30 μg of sample volume per well, voltage upper gel 80V, lower gel 100V, transfer membrane, incubate primary antibody b cell lymphoma 2 family protein (Bcl2) (1:1000, Abcam, USA) ,bcl-2-associated x protein(Bax) (1:1000, Abcam, USA) ,nuclear factor erythroid 2-related factor 2(Nrf2) (1:1000, ABclonal, CHN) ,recombinant NADH dehydrogenase, quinone 1(Noq1) (1: 1000, ABclonal, CHN),kelch like-ech associated protein1(Keap1) (1:1000, ABclonal, CHN) ,IL-1β (1:1000, Abcam, USA) ,nod-like receptor family pyrin domain containing3(Nlrp3)(1:1000, Abcam, USA) ,caspase-1(1:1000, Abcam, USA), Gadph (1:1000, Abcam, USA) overnight at 4°C in the refrigerator, the next day,tris buffered saline with tween (TBST) washed 5 times for 5 minutes each, incubated with goat anti-mouse horseradish peroxidase（HRP） secondary antibody (1:2000, Beyotime,CHN) for 1 hour at room temperature, TBST washed 5 times for 5 minutes each, and enhanced chemiluminescence (ECL) developer (Beyotime,CHN) was used to develop the image. The results were analyzed by ImageJ software.
Results
Animal Experiments
We established a full-thickness skin defect model in diabetic mice to investigate the differences in wound healing. On postoperative day 2, hemorrhagic spots appeared beneath the scabs in the diabetic group, whereas no bleeding was observed in the normal group. On day 4, the scabs in the normal group thickened and adopted a deep red color, while the diabetic group still exhibited sporadic bleeding. On day 6, partial scab detachment was seen in the normal group, in contrast to the diabetic group, which maintained an intact and thickened scab. By day 8, the normal group was nearing complete healing, with evident epithelialization, whereas the diabetic group retained an intact scab without significant epithelialization (Figure 1A).Masson staining revealed that collagen deposition in the diabetic group was sparse and disorganized (Figure 1C). Compared with the control group, the area of collagen deposition in the diabetic group was significantly reduced on days 4, 6, and 8 (Figure 1D), while no difference was observed on day 2. HE indicated that on day 2, the control group exhibited marked inflammatory cell infiltration accompanied by neovascularization, whereas the diabetic group displayed fewer neovessels; on day 4, the dermis in the control group was dense with mature vessels, but in the diabetic group, the dermis was sparse with fewer vessels; on day 6, re-epithelialization was observed in both groups, with the control group showing richer granulation tissue; and on day 8, tissue abundance was greater in the control group. By day 8, the control group revealed filled trabeculae and subsiding inflammation, while the diabetic group continued to exhibit trabecular defects and persistent inflammation (Figure 1E).Quantitative analysis revealed that at all four time points, both groups exhibited significant differences in epithelial thickness; except on day 2, epithelial length showed significant differences at all time points (Figure 1F , G).We examined the expression of clathrins in wounds from the diabetic and control groups on days 4 and 8. Immunohistochemistry revealed that, over time, the heavy chain of clathrins decreased in the control group but increased in the diabetic group; specifically, on day 4 the expression of clathrins in the diabetic group was three times that of the control group, and on day 8 it was ten times that of the control group (Figure 2B, C). The light chain protein also demonstrated a decreasing trend in the control group, whereas it showed an increasing trend in the diabetic group, with its expression on day 8 being twice that observed in the control group (Figure 2D, E).IHC analysis of OS and inflammation‐related protein expression in diabetic wounds revealed that the vascular marker CD31 increased over time in both groups, although its expression in the diabetic group was significantly lower than in the control group (Figure 3 A ,B), indicating impaired angiogenesis. Keap1 levels decreased in both groups, yet its expression remained continuously elevated in the diabetic group (Figure 3 C,D), suggesting dysregulation of OS. Furthermore, the key antioxidant factor Nrf2 exhibited lower levels in the diabetic group on day 4 compared to the control group, with a reversal observed on day 8 (Figure 3 E,F), reflecting compensatory activation at later stages.
Cell experiments
Primary macrophages matured to day 5 were polarized with IL-4 and LPS, then incubated in a hypoxic chamber with a serum concentration of 1% for 24 h. Subsequently, the cells were divided into 10 mM glucose group, 10 mM glucose plus 2DG group, 17.5 mM glucose group and 17.5 mM glucose plus 2DG group, and coverslips were prepared. Cellular immunofluorescence was employed to assess the expression levels of the target proteins CD86, iNOS, CD206, and Arg1. Compared with the 10 mm group, the expression of these target proteins declined to varying degrees in the other three groups (Figure 4 A, B).Real-time quantitative PCR analysis revealed that under conditions of 17.5 mM high glucose and 2DG-induced inhibition of glucose metabolism, the expression levels of clathrin adaptor proteins AP-1, AP-2, AP-3, and AP-4 were significantly reduced compared to the 10 mM group (Figure 5 A). Concurrently, the expression of phagocytic receptors CD16 and CD32 was markedly downregulated in the d 17.5 mM glucose plus 2DG group (Figure 5 B , C). Furthermore, another study demonstrated that within the d 17.5 mM glucose plus 2DG group, the pro-inflammatory cytokines IL-6 and IL-1β were elevated, while the anti-inflammatory cytokines IL-10 and TGF-β were significantly decreased (Figure 5E–I).Protein blot analysis revealed that, in the high-glucose combined with glycolysis inhibition ，d 17.5 mM glucose plus 2DG group, the expression of OS and inflammation-related proteins was significantly upregulated. Specifically, the levels of the Nlrp3 inflammasome, xcaspase-1, and IL-1β were higher than those in the normal 10 mM glucose group (Figure 6A ,B). Additionally, the pro-apoptotic protein and the Bax/Bcl-2 ratio were markedly elevated ( Figure 6C ,D), indicating an increase in cell apoptosis.
Discussion
The clusters of reactive oxygen species produced by inflammatory cells in the wound contribute to wound decontamination when present in appropriate amounts but cause cellular damage and delay repair when in excess [24,25]. As a chronic metabolic disease, diabetes is characterized by a state of chronic low-grade inflammation, which is a critical factor in impaired wound healing [26,27]. In the diabetic milieu, macrophages exhibit dysfunctional activity and are polarized towards the M1 phenotype [28,29]. Additionally, a high-glucose environment modifies the accumulation of advanced glycation end products (AGEs) through epigenetic alterations, thereby impairing their phagocytic function [30,31]. Moreover, clathrin-mediated endocytosis (CME) is an essential intracellular transport process that plays significant roles in material transport, signal transduction, and pathogen invasion; however, its role in diabetic wounds has been scarcely studied [32,33].In this study, a diabetic mouse model was established to compare the healing of diabetic wounds with that of normal wounds, aiming to explore the molecular mechanisms underlying clinical treatment. The results indicate that diabetic wounds exhibit multiple healing impairments.
The newly formed epithelium exhibited insufficient length and thickness, with markedly reduced collagen deposition and angiogenesis, as evidenced by decreased CD31 expression. This reflects impaired neovascularization, resulting in an inadequate oxygen supply to the wound. A comparative analysis of wound healing in DM versus normal conditions provides a theoretical basis for clinical treatment and intervention strategies. In this study, an in vitro cell model combining high glucose and 2DG was established, for the first time simulating the dual impairment of cellular glucose metabolism in DM—characterized by hyperglycemia and impaired glucose utilization—and investigating the underlying mechanisms of macrophage dysfunction.In a diabetic environment, macrophages exhibit marked dysfunction, with impaired phagocytic capacity and decreased expression of network proteins and phagocytic receptors, such as AP-1, AP-2, AP-3, and AP-4, which compromises pathogen clearance and increases the risk of infection. Additionally, the imbalance in inflammatory cytokine expression—characterized by low IL-10 and TGF-β levels alongside high IL-6 levels—disrupts the inflammatory–anti-inflammatory equilibrium essential for wound healing. The diminished degree of macrophage polarization, with a propensity toward M1 differentiation and simultaneous reductions in both M1 and M2 markers, further impairs the tissue repair process.At the molecular mechanism level, this study presents several innovative findings that, for the first time, reveal a novel mechanism underlying the interaction between OS and inflammation. It confirms that in a diabetic environment, an imbalance in the Keap1-Nrf2 pathway leads to decreased antioxidant capacity, reduced expression of Nqo1, and enhanced activation of Nlrp3 inflammasomes, thereby forming a vicious cycle of “OS-inflammation” that exacerbates tissue damage. Moreover, hyperglycemia inhibits Nrf2 nuclear translocation, altering the expression of the anti-apoptotic gene Bax and the pro-apoptotic factor Bcl-2, which unveils the molecular pathway by which metabolic dysregulation modulates immune cell fate.
Our study has identified the key therapeutic targets and clinical strategies for diabetic wound healing. The use of biomimetic dressings that leverage CME can enhance the ability of macrophages to clear pathogens. Immune modulation—either by correcting macrophage polarization or by supplementing anti-inflammatory cytokines—can restore wound homeostasis. We propose a macrophage-based disease prognosis management system, the core of which is the realization of precision medical intervention through molecular monitoring and targeted therapy. Macrophages play a central role in inflammation, metabolism, and immune regulation; by analyzing their functional status, it is possible to predict disease progression and guide stage-specific clinical interventions, thereby developing dynamic treatment strategies for different phases of the disease and avoiding a one-size-fits-all approach.Translational approaches include monitoring the Keap1-Nrf2 ratio and Nlrp3 inflammasome activity, combining antioxidant and anti-inflammatory treatments, and implementing personalized immunometabolic therapy. This strategy converts basic research into clinical tools, thereby fostering the advancement of precision medicine, particularly for complex diseases. Future studies should elucidate the interplay between the Nrf2-inflammatory pathway and extend these findings to diabetic complications to refine treatment strategies, enhance prognoses, and alleviate the healthcare burden.
conclusion
Diabetic wounds feature macrophage dysfunction due to Keap1-Nrf2/Nlrp3 dysregulation and defective CME. Therapies targeting Nrf2 activation, inflammasome inhibition, or biomimetic dressings may restore healing, warranting further mechanistic study.
Availability of data and material
The data and material support that finding could be found.
Ethics declarations
Competing interests:The authors declare no competing interests.
Contributions
The cell experiment of this study was completed by LNP,ZHL.and the experimental solution configuration was completed by LNP.The animal experiment was completed by LNP,ZHL,YH.The experimental project was proposed and planned by WFH and GXL.
Corresponding author
Correspondence to Gaoxing Luo , Weifeng He .
Acknowledgements
This work was supported by grants from the National Natural Sciences Foundation of China (No. 81630055 and No. 81920108022 to GXL; No. 82172232 and No. 31872742 to WFH), the Military Medical Science and Technology Youth Training Program of the Army Military Medical University (Third Military Medical University) (No. 20QNPY024 to WFH) and the Special Project for Enhancing Science and Technology Innovation Ability (frontier exploration) of the Army Military Medical University (Third Military Medical University) (No. 2019XQY12 to WFH).
References
[1]Knox S, O’Boyle NM. Skin lipids in health and disease: A review. Chem Phys Lipids. 2021;236:105055.
[2]Prost-Squarcioni C. Histologie de la peau et des follicules pileux [Histology of skin and hair follicle]. Med Sci (Paris). 2006;22(2):131-137.
[3]Kloc M, Ghobrial RM, Wosik J, Lewicka A, Lewicki S, Kubiak JZ. Macrophage functions in wound healing. J Tissue Eng Regen Med. 2019;13(1):99-109.
[4] Louiselle AE, Niemiec SM, Zgheib C, Liechty KW. Macrophage polarization and diabetic wound healing. Transl Res. 2021;236:109-116. 4[5]Fu X. Wound healing center establishment and new technology application in improving the wound healing quality in China. Burns Trauma. 2020;8:tkaa038.
[6]Abate MCMO, Aroucha PMT, Nóbrega DVMD, Rocha IPM, Soares SD, Reis AA, Paliares IC, Giuffrida FMA, Dib SA, Reis AF, Sa JR. Cutaneous manifestations of diabetes mellitus: a narrative review. Einstein (Sao Paulo). 2025 Mar 17;23:eRW1193.
[7]Abdelhakeem E, Monir S, Teaima MHM, Rashwan KO, El-Nabarawi M. State-of-the-Art Review of Advanced Electrospun Nanofiber Composites for Enhanced Wound Healing. AAPS PharmSciTech. 2023;24(8):246.
[8]He S, Cao H, Thålin C, Svensson J, Blombäck M, Wallén H. The Clotting Trigger Is an Important Determinant for the Coagulation Pathway In Vivo or In Vitro-Inference from Data Review. Semin Thromb Hemost. 2021;47(1):63-73.
[9] Afshar-Kharghan V, Thiagarajan P. Leukocyte adhesion and thrombosis. Curr Opin Hematol. 2006;13(1):34-39.
[10] Suzuki K. Chronic Inflammation as an Immunological Abnormality and Effectiveness of Exercise. Biomolecules. 2019;9(6):223.
[11]Ahmad I, Naqvi RA, Valverde A, Naqvi AR. LncRNA MALAT1/microRNA-30b axis regulates macrophage polarization and function. Front Immunol. 2023;14:1214810.
[12]Hassanshahi A, Moradzad M, Ghalamkari S, Fadaei M, Cowin AJ, Hassanshahi M. Macrophage-Mediated Inflammation in Skin Wound Healing. Cells. 2022;11(19):2953.
[19]Gerhardt H, Golding M, Fruttiger M, et al. VEGF guides angiogenic sprouting utilizing endothelial tip cell filopodia. J Cell Biol. 2003;161(6):1163-1177.
[20]Orzechowski A, Cywińska A, Rostagno AA, Rizzi FM. Oxidative Stress, Chronic Inflammation, and Amyloidoses. Oxid Med Cell Longev. 2019;2019:6024975.
[21]Atri C, Guerfali FZ, Laouini D. Role of Human Macrophage Polarization in Inflammation during Infectious Diseases. Int J Mol Sci. 2018;19(6):1801.
[22]Liu F, Qiu H, Xue M, Zhang S, Zhang X, Xu J.MSC-secreted TGF-β regulates lipopolysaccharide-stimulated macrophage M2-like polarization via the Akt/FoxO1 pathway. Stem Cell Res Ther. 2019;10(1):345.
[23]Irizarry-Caro RA, McDaniel MM, Overcast GR, Jain VG, Troutman TD, Pasare C. TLR signaling adapter BCAP regulates inflammatory to reparatory macrophage transition by promoting histone lactylation. Proc Natl Acad Sci U S A. 2020;117(48):30628-30638.
[24]Barnes JA, Eid MA, Creager MA, Goodney PP. Epidemiology and Risk of Amputation in Patients With Diabetes Mellitus and Peripheral Artery Disease. Arterioscler Thromb Vasc Biol. 2020 Aug;40(8):1808-1817.
[25]Gerber PA, Rutter GA. The Role of Oxidative Stress and Hypoxia in Pancreatic Beta-Cell Dysfunction in Diabetes Mellitus. Antioxid Redox Signal. 2017 Apr 1;26(10):501-518.
[26]Cai F, Wang P, Chen W, Zhao R, Liu Y. The physiological phenomenon and regulation of macrophage polarization in diabetic wound. Mol Biol Rep. 2023;50(11):9469-9477.
[27] Zheng S, Zeng Y, Chu L, Gong T, Li S, Yang M. Renal Tissue-Derived Exosomal miRNA-34a in Diabetic Nephropathy Induces Renal Tubular Cell Fibrosis by Promoting the Polarization of M1 Macrophages. IET Nanobiotechnol. 2024;2024:5702517.
[28]Marro BS, Legrain S, Ware BC, Oldstone MB. Macrophage IFN-I signaling promotes autoreactive T cell infiltration into islets in type 1 diabetes model. JCI Insight. 2019 Jan 24;4(2):e125067.
[29]Wolf SJ, Melvin WJ, Gallagher K. Macrophage-mediated inflammation in diabetic wound repair. Semin Cell Dev Biol. 2021;119:111-118.
[30]Zheng J, Hu Q, Zou X, Xu G, Cao Y. Uranium induces kidney cells pyroptosis in culture involved in ROS/Nlrp3/caspase-1 signaling. Free Radic Res. 2022;56(1):40-52.
[31]Bai B, Yang Y, Wang Q, et al. Nlrp3inflammasome in endothelial dysfunction. Cell Death Dis. 2020;11(9):776.
[32]MUKHERJEE S, GHOSH R N, MAXFIELD F K. Endocytosis [ J] . Physiological Review , 1997, 77: 759-803.
[33]KIRCHHAUSEN T. Clathrin [ J] . Annual Review Biochemistry, 2000, 69: 699-727 .
